Findings. As per routine hospital protocol, a follow-up was performed on

Findings. As per routine hospital protocol, a follow-up was performed on all patients based on their culture results which were available 4? weeks after inoculation. Definite-TB: Smear positive and Culture positive (S+C+) or smear negative, culture positive (S2C+) Probable-TB. Smear positive and culture negative(S+C2) Smear negative and Culture negative(S2C2) but clinical-radiological picture highly indicative of TB. Patients showing a response to anti-TB treatment at follow-up were assigned to this group. During the follow up, the following queries were addressed to patients: whether empirical anti-TB Treatment was initiated at a previous visit(s); whether the Fingolimod (hydrochloride) patient had a previous Finafloxacin manufacturer history of TB;, whether the patient had contact history Of TB; supportive findings of TB in any another clinical tests, e.g. Radiology. Patients who responded “yes” to any of the queries or had supportive findings indicative of TB were included in this group. Non-TB. Smear negative culture negative (S2C2) Patient was assessed as `clinically negative’ when the patient had no previous history of TB infection and no microbiological evidence Table 1. Primers used for nested PCR.indicating current infection. Patients were symptomatic (weight loss and prolonged cough) but showed improvement without antiTB treatment.Nested PCR1. Nucleic acid extraction. Untreated sputum specimens were processed using the Qiagen QIAamp DNA mini kit (Qiagen) with the following modifications: 1) 30 mg/ml lysozyme (Amresco) was added to the sputum specimen which was then kept at 37uC overnight to ensure enzymatic digestion 2) This was followed by addition of 250 ml lysis buffer (AL buffer from the QIAamp kit) and 25 ml Proteinase K and incubation at 56uC for 2 hours. DNA was then extracted as per manufacturer’s recommendations in a total volume of 100 ml. 2. PCR. The multi-copy IS6110 sequence was selected as the target region for the nested PCR test (Table 1). The outer primers, INSF and INSR, were used to amplify a 245 bp fragment. IS1 and IS2 were used as inner primers for the nested PCR, yielding a 123 bp fragment. Primers were purchased from Sigma. The inhouse nested PCR was performed as described previously [8]. Briefly, 20 ml of extracted DNA was added to 80 ml of mastermix to bring the total reaction volume to a 100 ml. PCR was run on the Eppendorf Mastercycler gradient. Amplicons was detected by gel electrophoresis using a 3 agarose gel. An internal amplification control, b-globin, was used to detect PCR inhibition in extracts. InPrimer Forward:59CGTGAGGGCATCGAGGTGGC39 Reverse:5GCGTAGGCGTCGGTGACAAA39 Forward:59CTCGTCCAGCGCCGCTTCGG39 Reverse:59CCTGCGAGCGTAGGCGTCGG39 Forward:59TGAACGTGGATGAAGTTGGTGGTG39 Reverse:59ACTTTCTTGCCATGAGCCTTCACCTT3 doi:10.1371/journal.pone.0051121.tRegion INSProduct size 245 bpNucleotides 631?50 856?IS123 bp762?81 865?b-globin291 bp-Truenat MTB DiagnosisFigure 4. Enlistment and outcome of study. doi:10.1371/journal.pone.0051121.gcase of inhibition the PCR, was repeated after dilution of DNA in a 1:1 ratio with sterile water.Truenat MTB test1. DNA extraction using Trueprep-MAG protocol. Untreated sputum specimens were liquefied with 500 ml of liquefaction buffer. The liquefied sputum was centri-fuged at 14000 rpm for 5 minutes. After discarding supernatant, sputum pellets were re-suspended with 500 ml of lysis buffer and the suspension was incubated at 90uC for 10 minutes in the extraction tube (Fig. 2). After the lysis step, 500 ml of Binding Reage.Findings. As per routine hospital protocol, a follow-up was performed on all patients based on their culture results which were available 4? weeks after inoculation. Definite-TB: Smear positive and Culture positive (S+C+) or smear negative, culture positive (S2C+) Probable-TB. Smear positive and culture negative(S+C2) Smear negative and Culture negative(S2C2) but clinical-radiological picture highly indicative of TB. Patients showing a response to anti-TB treatment at follow-up were assigned to this group. During the follow up, the following queries were addressed to patients: whether empirical anti-TB Treatment was initiated at a previous visit(s); whether the patient had a previous history of TB;, whether the patient had contact history Of TB; supportive findings of TB in any another clinical tests, e.g. Radiology. Patients who responded “yes” to any of the queries or had supportive findings indicative of TB were included in this group. Non-TB. Smear negative culture negative (S2C2) Patient was assessed as `clinically negative’ when the patient had no previous history of TB infection and no microbiological evidence Table 1. Primers used for nested PCR.indicating current infection. Patients were symptomatic (weight loss and prolonged cough) but showed improvement without antiTB treatment.Nested PCR1. Nucleic acid extraction. Untreated sputum specimens were processed using the Qiagen QIAamp DNA mini kit (Qiagen) with the following modifications: 1) 30 mg/ml lysozyme (Amresco) was added to the sputum specimen which was then kept at 37uC overnight to ensure enzymatic digestion 2) This was followed by addition of 250 ml lysis buffer (AL buffer from the QIAamp kit) and 25 ml Proteinase K and incubation at 56uC for 2 hours. DNA was then extracted as per manufacturer’s recommendations in a total volume of 100 ml. 2. PCR. The multi-copy IS6110 sequence was selected as the target region for the nested PCR test (Table 1). The outer primers, INSF and INSR, were used to amplify a 245 bp fragment. IS1 and IS2 were used as inner primers for the nested PCR, yielding a 123 bp fragment. Primers were purchased from Sigma. The inhouse nested PCR was performed as described previously [8]. Briefly, 20 ml of extracted DNA was added to 80 ml of mastermix to bring the total reaction volume to a 100 ml. PCR was run on the Eppendorf Mastercycler gradient. Amplicons was detected by gel electrophoresis using a 3 agarose gel. An internal amplification control, b-globin, was used to detect PCR inhibition in extracts. InPrimer Forward:59CGTGAGGGCATCGAGGTGGC39 Reverse:5GCGTAGGCGTCGGTGACAAA39 Forward:59CTCGTCCAGCGCCGCTTCGG39 Reverse:59CCTGCGAGCGTAGGCGTCGG39 Forward:59TGAACGTGGATGAAGTTGGTGGTG39 Reverse:59ACTTTCTTGCCATGAGCCTTCACCTT3 doi:10.1371/journal.pone.0051121.tRegion INSProduct size 245 bpNucleotides 631?50 856?IS123 bp762?81 865?b-globin291 bp-Truenat MTB DiagnosisFigure 4. Enlistment and outcome of study. doi:10.1371/journal.pone.0051121.gcase of inhibition the PCR, was repeated after dilution of DNA in a 1:1 ratio with sterile water.Truenat MTB test1. DNA extraction using Trueprep-MAG protocol. Untreated sputum specimens were liquefied with 500 ml of liquefaction buffer. The liquefied sputum was centri-fuged at 14000 rpm for 5 minutes. After discarding supernatant, sputum pellets were re-suspended with 500 ml of lysis buffer and the suspension was incubated at 90uC for 10 minutes in the extraction tube (Fig. 2). After the lysis step, 500 ml of Binding Reage.