Ained nuclei from the tumor areas [14]. HER2 protein expression was scored

Ained nuclei from the tumor areas [14]. HER2 protein expression was scored in a scale from 0 to 3+, the latter corresponding to uniform, intense membrane staining in .30 invasive tumor cells [15].Patients and MethodsThis was a retrospective translational research study amongst patients who had been enrolled in two prospective clinical trials (A REMARK diagram is provided in Fig. 1). The HeCOG prospective trial HE10/97 randomised a total of 595 high-risk (T1-3N1M0 or T3N0M0) breast cancer patients to either four cycles of epirubicin followed by four cycles of intensified cyclophosphamide, methotrexate and 5-fluorouracil (E-CMF) or three cycles 15481974 of epirubicin followed by three cycles of paclitaxel and three cycles of intensified CMF (Lation of prey plasmids from each colony, the obtained GPCR clones E-T-CMF) every two weeks [12]. The prospective trial HE 10/10 randomized a similar population of 1121 node-positive, early breast cancer patients to the prior O provide the relevant auxotrophic components. For solid plates, 2 agar was ERT-PCRPrior to RNA isolation, macrodissection of tumor areas was performed in most of the FFPE sections with ,50 tumor cell content. RNA was isolated using a standardized fully automated isolation method for total RNA from FFPE tissue, based on silicagermanium-coated magnetic beads (XTRAKT RNA kits, STRATIFYER Molecular Pathology GmbH, Cologne, Germany) in combination with a the liquid handling robot XTRAKT XL (STRATIFYER Molecular Pathology GmbH, Cologne, Germany) . The method involves extraction-integrated deparaffinization and DNase I digestion steps. . The quality and quantity ofESR1 Gene Amplification in Early Breast CancerFigure 1. REMARK flow chart. doi:10.1371/journal.pone.0070634.gRNA was checked by measuring CALM2 expression as a surrogate for amplifiable mRNA by qRT-PCR. CALM2 was used as endogenous reference, since it had previously been identified as stably expressed among breast cancer tissue samples. Expression of the target gene, as well as the reference gene CALM2, was assessed in triplicate by qRT-PCR using the SuperScript III PLATINUM One-Step Quantitative RT-PCR System with ROX (Invitrogen, Karlsruhe, Germany) in a Stratagene Mx3005p (Agilent Technologies, Boblingen, Ger?many). The lengths of the amplicons detected by the ESR1 and CALM2 assays were 73 bp and 72 bp, respectively, with PCR efficiencies [E = 1(10-slope)] of 101.0 and 99.70 , respectively. Forty cycles of nucleic acid amplification were applied and the cycle threshold (CT) values of the target gene were identified. CT values were normalized by subtracting the CT value of the housekeeping gene CALM2 from the CT value of the target gene (DCT). RNA results were then reported as 40-DCT values, which correlate proportionally to the mRNA expression level of the target gene.A commercially available human reference RNA (Stratagene qPCR Human Reference Total RNA, Agilent Technologies, Waldbronn, Germany) was used as positive control. The Primer/Probe (FAM/TAMRA-labeled) sets used for amplification of the target and reference genes were the following (59R39): ESR1 (NM_000125) Probe ATGCCCTTTTGCCGATGCA Forward Primer GCCAAATTGTGTTTGATGGATTAA Reverse Primer GACAAAACCGAGTCACATCAGTAATAGCALM2 (NM_001743) Probe TCGCGTCTCGGAAACCGGTAGC Forward Primer GAGCGAGCTGAGTGGTTGTG Reverse Primer AGTCAGTTGGTCAGCCATGCTFISHTMA sections (5 mm thick) were cut for FISH analysis, using the ZytoLightH SPEC ESR1/centromere 6 (CEP6) dual color probe kit and the ZytoLightH SPEC HER2/TOP2A/centromere 17 (CEP17) triple color probe kit (both from ZytoVision, Bremerhaven, Germany). FISH was performed according.Ained nuclei from the tumor areas [14]. HER2 protein expression was scored in a scale from 0 to 3+, the latter corresponding to uniform, intense membrane staining in .30 invasive tumor cells [15].Patients and MethodsThis was a retrospective translational research study amongst patients who had been enrolled in two prospective clinical trials (A REMARK diagram is provided in Fig. 1). The HeCOG prospective trial HE10/97 randomised a total of 595 high-risk (T1-3N1M0 or T3N0M0) breast cancer patients to either four cycles of epirubicin followed by four cycles of intensified cyclophosphamide, methotrexate and 5-fluorouracil (E-CMF) or three cycles 15481974 of epirubicin followed by three cycles of paclitaxel and three cycles of intensified CMF (E-T-CMF) every two weeks [12]. The prospective trial HE 10/10 randomized a similar population of 1121 node-positive, early breast cancer patients to the prior ERT-PCRPrior to RNA isolation, macrodissection of tumor areas was performed in most of the FFPE sections with ,50 tumor cell content. RNA was isolated using a standardized fully automated isolation method for total RNA from FFPE tissue, based on silicagermanium-coated magnetic beads (XTRAKT RNA kits, STRATIFYER Molecular Pathology GmbH, Cologne, Germany) in combination with a the liquid handling robot XTRAKT XL (STRATIFYER Molecular Pathology GmbH, Cologne, Germany) . The method involves extraction-integrated deparaffinization and DNase I digestion steps. . The quality and quantity ofESR1 Gene Amplification in Early Breast CancerFigure 1. REMARK flow chart. doi:10.1371/journal.pone.0070634.gRNA was checked by measuring CALM2 expression as a surrogate for amplifiable mRNA by qRT-PCR. CALM2 was used as endogenous reference, since it had previously been identified as stably expressed among breast cancer tissue samples. Expression of the target gene, as well as the reference gene CALM2, was assessed in triplicate by qRT-PCR using the SuperScript III PLATINUM One-Step Quantitative RT-PCR System with ROX (Invitrogen, Karlsruhe, Germany) in a Stratagene Mx3005p (Agilent Technologies, Boblingen, Ger?many). The lengths of the amplicons detected by the ESR1 and CALM2 assays were 73 bp and 72 bp, respectively, with PCR efficiencies [E = 1(10-slope)] of 101.0 and 99.70 , respectively. Forty cycles of nucleic acid amplification were applied and the cycle threshold (CT) values of the target gene were identified. CT values were normalized by subtracting the CT value of the housekeeping gene CALM2 from the CT value of the target gene (DCT). RNA results were then reported as 40-DCT values, which correlate proportionally to the mRNA expression level of the target gene.A commercially available human reference RNA (Stratagene qPCR Human Reference Total RNA, Agilent Technologies, Waldbronn, Germany) was used as positive control. The Primer/Probe (FAM/TAMRA-labeled) sets used for amplification of the target and reference genes were the following (59R39): ESR1 (NM_000125) Probe ATGCCCTTTTGCCGATGCA Forward Primer GCCAAATTGTGTTTGATGGATTAA Reverse Primer GACAAAACCGAGTCACATCAGTAATAGCALM2 (NM_001743) Probe TCGCGTCTCGGAAACCGGTAGC Forward Primer GAGCGAGCTGAGTGGTTGTG Reverse Primer AGTCAGTTGGTCAGCCATGCTFISHTMA sections (5 mm thick) were cut for FISH analysis, using the ZytoLightH SPEC ESR1/centromere 6 (CEP6) dual color probe kit and the ZytoLightH SPEC HER2/TOP2A/centromere 17 (CEP17) triple color probe kit (both from ZytoVision, Bremerhaven, Germany). FISH was performed according.